View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10298_high_12 (Length: 343)
Name: NF10298_high_12
Description: NF10298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10298_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 8e-49; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 239 - 341
Target Start/End: Original strand, 21832797 - 21832899
Alignment:
| Q |
239 |
caaacccgtaacaataaaaacataacctaactccaaaccctaatatttttgtgtcaccgccagcaccatttttgcaccaacgttaccgtctttttgtgtt |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21832797 |
caaacccgtaacaataaaaacataacctaactccaaaccctaatatttttgtgtcaccgccagcaccatttttgcactaacgttaccgtctttttgtgtt |
21832896 |
T |
 |
| Q |
339 |
cac |
341 |
Q |
| |
|
||| |
|
|
| T |
21832897 |
cac |
21832899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 138 - 233
Target Start/End: Original strand, 21832402 - 21832497
Alignment:
| Q |
138 |
cgtaaatataacctaactccaaggatcattcagtaacgcaacagtacaaccataacctaactacaaaccctaacatttgtttcaccatccgttacc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21832402 |
cgtaaatataacctaactccaaggatcattcagtaacgcaacagtacaaccataacctaactacaaaccctaacatttgtttcaccatctgttacc |
21832497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 21832285 - 21832347
Alignment:
| Q |
19 |
agtgtggagaaataagtgttgccgataatccatttcctaattgaatgaagttgaattttatgt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21832285 |
agtgtggagaaataagtgttgccgataatccatttcccaattgaatgaagttgaattttatgt |
21832347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University