View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10298_high_19 (Length: 238)
Name: NF10298_high_19
Description: NF10298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10298_high_19 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 238
Target Start/End: Original strand, 27312863 - 27313086
Alignment:
| Q |
15 |
aagtgggattggtcaagtgcagtacgaaaggtttggaagtgaagaagaagagaattatttagggtttcttaggaatagttggaataacaaatcggtgaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312863 |
aagtgggattggtcaagtgcagtacgaaaggtttggaagtgaggaagaagagaattacttagggtttcttaggaatagttggaataacaaatcggtgaga |
27312962 |
T |
|
| Q |
115 |
aaatctcctatgaagtgtttgggagttgatatcgacaacgatgatgacgaacgatcctctgatcttttgtttcctgtgtagttaattgcaagagtggatc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312963 |
aaatctcctatgaagtgtttgggagttgatatcgacaacgatgatgacgaacgatcctctgatcttttgtttcctgtgtagttaattgcaagagtggatg |
27313062 |
T |
|
| Q |
215 |
attgtcacatgttgaaatacttgt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27313063 |
attgtcacatgttgaaatacttgt |
27313086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University