View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10298_low_22 (Length: 307)
Name: NF10298_low_22
Description: NF10298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10298_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 49202392 - 49202266
Alignment:
| Q |
1 |
agtgcttataataagaaacttgtctttgcaatgcatatcaggcggtgccgtgcgttgagcttgcatcgtaactagtacatccaaaaaataaacataagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49202392 |
agtgcttataataagaaacttgtctttgcaatgcatatcagggggtgccgtgcgttgagcttgcatcgtaactagtacatccaaaaaataaacataagcc |
49202293 |
T |
|
| Q |
101 |
agtaacttgtgttacttgaatcatact |
127 |
Q |
| |
|
| ||||||||||||||||||||||||| |
|
|
| T |
49202292 |
aataacttgtgttacttgaatcatact |
49202266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 171 - 289
Target Start/End: Complemental strand, 49202224 - 49202106
Alignment:
| Q |
171 |
tgaattgagccttaaacaagaaggtaaatgnnnnnnntaccagtgaaatcacatttatcctttggcttgatgatgcctatattaggtctaacgcagtact |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49202224 |
tgaattgagccttaaacaagaaggtaaatgaaaaaaataccagtgaaatcacatttatcctttggcttgatgatgcctatattaggtctaacgcagtact |
49202125 |
T |
|
| Q |
271 |
tcttcggcgacgtagtttt |
289 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
49202124 |
tcttcggcgacgtagtttt |
49202106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University