View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10298_low_25 (Length: 287)
Name: NF10298_low_25
Description: NF10298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10298_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 58 - 170
Target Start/End: Complemental strand, 56377168 - 56377056
Alignment:
| Q |
58 |
gtaagttgctttggtttgctttgcttgcactatcagccatcgagtttacgccatatagaaagagaggagcannnnnnnnnnnncagatagtggtgaggac |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
56377168 |
gtaagttgctttggtttgctttgcttgcactatcagccatcgagtttacgccatatagaaagagaggagcagtgtgtgtgtgtcagatagtggtgaggac |
56377069 |
T |
|
| Q |
158 |
aaaagatgcctgg |
170 |
Q |
| |
|
||||||||||||| |
|
|
| T |
56377068 |
aaaagatgcctgg |
56377056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 230 - 272
Target Start/End: Complemental strand, 56376996 - 56376954
Alignment:
| Q |
230 |
gatcattagttaatgtttttgaaattgttgttatgttatgagt |
272 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
56376996 |
gatcattagttaatgtttttgaaagtgtagttatgttatgagt |
56376954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University