View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10298_low_27 (Length: 258)
Name: NF10298_low_27
Description: NF10298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10298_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 242
Target Start/End: Original strand, 48794225 - 48794455
Alignment:
| Q |
13 |
aaggtcatccacacatattcaaaatctcaaagcacataatcatttgtcagtggcgttcaggtgcgcgtgatcctcattattgagttgagatagtgcagaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48794225 |
aaggtcatccacacatattcaaaatctcaaagcacataatcatttgtcagtggcgttcaggtgcgcgtgatcctcattattgagttgagatagtgcagaa |
48794324 |
T |
 |
| Q |
113 |
cacacatatagaagtgttatgttctgatatg-aaatctcagtttttcaggacgaagaatgagtttaaaacataataattaaaaaatacagagcctgaaat |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48794325 |
cacacatatagaagtgttatgttatgatatgaaaatctcagtttttcaggacgaagaatgagtttaaaacataataattaaaaaatacagagcctgaaat |
48794424 |
T |
 |
| Q |
212 |
tgtactactccattttttatcttcttcttat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48794425 |
tgtactactccattttttatcttcttcttat |
48794455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University