View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10298_low_30 (Length: 227)
Name: NF10298_low_30
Description: NF10298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10298_low_30 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 37735719 - 37735946
Alignment:
| Q |
1 |
acatcggtctaagatctagaatgtgaaaactatgataacgatttagttagaattgcttgaagttgagtgcatttggagttcgtgtcaattgtttttaacc |
100 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37735719 |
acatcggtctaagatttagagtgtgaaaactatgataacgatttagttagagttgcttgaagttgagtgcatttggagttcgtgtcaattgtttttaacc |
37735818 |
T |
 |
| Q |
101 |
aaaaaactagtaatataattgctatctttctaaccttccgatttttaaagaaaaaggatttgataatacaaaatttgatcaaaa-tccgtaaaatttaac |
199 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37735819 |
aaaaaactagtaatataactgctatctttctaaccttccgatttttaaagaaaaagggtttgataatacaaaatttgatcaaaagtccgtaaaatttaac |
37735918 |
T |
 |
| Q |
200 |
tagtaattattttccaacaatatgtcct |
227 |
Q |
| |
|
|||||||| |||||||| |||||||||| |
|
|
| T |
37735919 |
tagtaattcttttccaataatatgtcct |
37735946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University