View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1030-Insertion-7 (Length: 149)
Name: NF1030-Insertion-7
Description: NF1030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1030-Insertion-7 |
 | |
|
| [»] scaffold1652 (1 HSPs) |
| | |
|
| [»] scaffold1176 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 9e-56; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 9e-56
Query Start/End: Original strand, 7 - 128
Target Start/End: Original strand, 37253141 - 37253262
Alignment:
| Q |
7 |
agatggagcgttcttcacaggtactggagcagatgccgccggtgagtcagcggagggagagatcgcaggtgtggcaacaggggatatggtgggagataaa |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37253141 |
agatggagcgttcttcacaggtatgggagcagatgccgccggtgagtcagcggagggagagatcgcaggtgtggcaacaggggatatggtgggagatgaa |
37253240 |
T |
|
| Q |
107 |
gatggagattgagcgaaggtag |
128 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37253241 |
gatggagattgagcgaaggtag |
37253262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 4e-30
Query Start/End: Original strand, 18 - 120
Target Start/End: Original strand, 37237812 - 37237914
Alignment:
| Q |
18 |
tcttcacaggtactggagcagatgccgccggtgagtcagcggagggagagatcgcaggtgtggcaacaggggatatggtgggagataaagatggagattg |
117 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||| |||||| | || |||||||| |
|
|
| T |
37237812 |
tcttcacaggtacgggaggagatgccaccggtgagtcagcggagggagagatcgcaggtgtggcaacgggtgatatggttggagatgatgaaggagattg |
37237911 |
T |
|
| Q |
118 |
agc |
120 |
Q |
| |
|
||| |
|
|
| T |
37237912 |
agc |
37237914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 7 - 75
Target Start/End: Original strand, 37232892 - 37232960
Alignment:
| Q |
7 |
agatggagcgttcttcacaggtactggagcagatgccgccggtgagtcagcggagggagagatcgcagg |
75 |
Q |
| |
|
|||||||| |||||||||||| | |||| |||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
37232892 |
agatggagaattcttcacaggtgcgggaggagatgcagccggtgagtgagcggagggagagatcgcagg |
37232960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 11 - 66
Target Start/End: Original strand, 37257249 - 37257304
Alignment:
| Q |
11 |
ggagcgttcttcacaggtactggagcagatgccgccggtgagtcagcggagggaga |
66 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||| ||||||| ||||| |
|
|
| T |
37257249 |
ggagcgttcttcacaggtacgggaggagatgccaccggtgagacagcggaaggaga |
37257304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 37245070 - 37245129
Alignment:
| Q |
18 |
tcttcacaggtactggagcagatgccgccggtgagtcagcggagggagagatcgcaggtg |
77 |
Q |
| |
|
||||| |||| || |||||||||||||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
37245070 |
tcttcgcaggcacgggagcagatgccgccgttgagttagcggagggagaaatcgctggtg |
37245129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1652 (Bit Score: 38; Significance: 0.0000000000008; HSPs: 1)
Name: scaffold1652
Description:
Target: scaffold1652; HSP #1
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 453 - 396
Alignment:
| Q |
18 |
tcttcacaggtactggagcagatgccgccggtgagtcagcggagggagagatcgcagg |
75 |
Q |
| |
|
||||||||||||| |||||||||||| ||| ||||| |||||||||||| |||||||| |
|
|
| T |
453 |
tcttcacaggtacgggagcagatgccaccgttgagttagcggagggagaaatcgcagg |
396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 1351 - 1294
Alignment:
| Q |
18 |
tcttcacaggtactggagcagatgccgccggtgagtcagcggagggagagatcgcagg |
75 |
Q |
| |
|
||||||||||||| ||||| ||||||||| ||||| ||| |||||||| |||||||| |
|
|
| T |
1351 |
tcttcacaggtacacgagcatatgccgccgttgagttagctgagggagaaatcgcagg |
1294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University