View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10300_low_6 (Length: 207)
Name: NF10300_low_6
Description: NF10300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10300_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 83 - 201
Target Start/End: Complemental strand, 42116169 - 42116051
Alignment:
| Q |
83 |
aaaaacccctccttgaagaatggacattattttgtttatatgatactccaagattgattgattgtattttaagcaacttggcataataattcacatttat |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42116169 |
aaaaacccctccttgaagaatggacattattttgtttatatgatactccaagattgattgattgtattttaagaaacttggcataataattcacatttat |
42116070 |
T |
|
| Q |
183 |
atgacccttttacctttgc |
201 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42116069 |
atgacccttttacctttgc |
42116051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 89 - 182
Target Start/End: Complemental strand, 32007486 - 32007394
Alignment:
| Q |
89 |
ccctccttgaagaatggacattattttgtttatatgatactccaagattgattgattgtattttaagcaacttggcataataattcacatttat |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32007486 |
ccctccttgaagaatggacattattttgttt-tccaatactccaagattgattgattgtattttaagcaacttggcataatatttcacatttat |
32007394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University