View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_1D_high_10 (Length: 287)
Name: NF10301_1D_high_10
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_1D_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 37863406 - 37863669
Alignment:
| Q |
1 |
ggcatgtaccaaaagaggagtagttcctagcattaatttgccaccattttcttctcatccttgttattgtcgtcgacggcattagctgtggaatgaaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863406 |
ggcatgtaccaaaagaggagtagtacctagcattaatttgccaccattttcttctcatccttgttattgtcgtcgacggcattagctgtggaatgaaagg |
37863505 |
T |
 |
| Q |
101 |
cgaaaatgttgttggagaaggaagccggattttttagggtgacataggctttcttataatctggttttgcgactaagctgcgattcttggacggttttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863506 |
cgaaaatgttgttggagaaggaagccggattttttagggtgacataggctttcttataatctggttttgcgactaagctgcgattcttggacggttttcc |
37863605 |
T |
 |
| Q |
201 |
tttaacgttcaacgttcgaacttttttaacttccaactgatagaaggattcgacgacatgtttg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863606 |
tttaacgttcaacgttcgaacttttttaacttccaactgatagaaggattcgacgacatgtttg |
37863669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University