View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_1D_high_15 (Length: 245)
Name: NF10301_1D_high_15
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_1D_high_15 |
 |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0197 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 3354 - 3585
Alignment:
| Q |
1 |
tttccatcagcatcaaatgttgtcatgtcactctcttgttgaactagaacttggtcagttggtgactctccttggctccttctcttcactgagcttgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3354 |
tttccatcagcatcaaatgttgtcatgtcactctcttgttgaactagaacttggtcagttggtgactctccttggctccttctcttcactgagcttgaac |
3453 |
T |
 |
| Q |
101 |
caatgtttcttgcctgtggcctaatgatttgaacatctttggatgattgtgacctatcttgatcagcttctagagcatttagttttttgcttagatgaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3454 |
caatgtttcttgcctgtggcctaatgatttgaacatctttggatgattgtgacctatcttgatcagcttctagagcatttagttttttgcttagatgaca |
3553 |
T |
 |
| Q |
201 |
gttccaatagtttttcacgtcatttgatgtcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
3554 |
gttccaatagtttttcacgtcatttgctgtcc |
3585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University