View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10301_1D_high_6 (Length: 353)

Name: NF10301_1D_high_6
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10301_1D_high_6
NF10301_1D_high_6
[»] chr5 (1 HSPs)
chr5 (23-332)||(42348929-42349238)
[»] chr7 (2 HSPs)
chr7 (25-143)||(19057201-19057310)
chr7 (286-332)||(19057447-19057493)
[»] chr3 (4 HSPs)
chr3 (25-143)||(50804878-50804987)
chr3 (25-143)||(50870890-50870999)
chr3 (285-332)||(50804692-50804742)
chr3 (285-332)||(50871135-50871185)


Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 332
Target Start/End: Original strand, 42348929 - 42349238
Alignment:
23 accaagacggttctacctacgcggttttgttacctcttttggaaggagatttcagggctgttcttcaggggaatgatcaaaatgaaattgagatttgtgt 122  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42348929 accaagatggttctacctacgcggttttgttacctcttttggaaggagatttcagggctgttcttcaggggaatgatcaaaatgaaattgagatttgtgt 42349028  T
123 cgaaagtggtatgcactcttcataaatttgttaatgttttttgtgtgtgtaaaccatgtatcctccacacataaatgtagaaactaaaccgtcgagttgc 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42349029 cgaaagtggtatgcactcttcataaatttgttaatgttttttgtgtgtgtaaaccatgtatcctccacacataaatgtagaaactaaaccgtcgagttgc 42349128  T
223 gtaggatcacagtgcgcagagtagtgtatgttaggtatgcattgtgattttttgccatgtgcatgattgtaggatgtcctgatgtggaggaatttgatgg 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
42349129 gtaggatcacagtgcgcagagtagtgtatgttaggtatgcattgtgattttttgctatgtgcatgattgtaggatgtcctgatgtggaggaatttgatgg 42349228  T
323 gactcatttg 332  Q
    ||||||||||    
42349229 gactcatttg 42349238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 25 - 143
Target Start/End: Original strand, 19057201 - 19057310
Alignment:
25 caagacggttctacctacgcggttttgttacctcttttggaaggagatttcagggctgttcttcaggggaatgatcaaaatgaaattgagatttgtgtcg 124  Q
    ||||| ||||||||||||| |||||||||||| ||| ||||||||||||||||||||| ||||||||||         ||||||||||||||||||||||    
19057201 caagatggttctacctacgtggttttgttaccacttctggaaggagatttcagggctgctcttcagggg---------aatgaaattgagatttgtgtcg 19057291  T
125 aaagtggtatgcactcttc 143  Q
    ||||||||||| |||||||    
19057292 aaagtggtatgtactcttc 19057310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 286 - 332
Target Start/End: Original strand, 19057447 - 19057493
Alignment:
286 tgattgtaggatgtcctgatgtggaggaatttgatgggactcatttg 332  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
19057447 tgattgtaggatgtcctgatgtggaggaatttgatgggactcatttg 19057493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 59; Significance: 6e-25; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 25 - 143
Target Start/End: Complemental strand, 50804987 - 50804878
Alignment:
25 caagacggttctacctacgcggttttgttacctcttttggaaggagatttcagggctgttcttcaggggaatgatcaaaatgaaattgagatttgtgtcg 124  Q
    ||||| ||||||||||||| |||||||||||| ||| ||||||||||||||||||||| |||||||||||         ||||||||||||||||||| |    
50804987 caagatggttctacctacgtggttttgttaccacttctggaaggagatttcagggctgctcttcagggga---------atgaaattgagatttgtgttg 50804897  T
125 aaagtggtatgcactcttc 143  Q
    ||||||||||| |||||||    
50804896 aaagtggtatgtactcttc 50804878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 25 - 143
Target Start/End: Original strand, 50870890 - 50870999
Alignment:
25 caagacggttctacctacgcggttttgttacctcttttggaaggagatttcagggctgttcttcaggggaatgatcaaaatgaaattgagatttgtgtcg 124  Q
    ||||| ||||||||||||| |||||||||||| ||| ||||||||||||||||||||| ||||||||||         |||||||||||||||||||| |    
50870890 caagatggttctacctacgtggttttgttaccacttctggaaggagatttcagggctgctcttcagggg---------aatgaaattgagatttgtgttg 50870980  T
125 aaagtggtatgcactcttc 143  Q
    ||||||||||| |||||||    
50870981 aaagtggtatgtactcttc 50870999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 332
Target Start/End: Complemental strand, 50804742 - 50804692
Alignment:
285 atgattgtaggatgtcctgatg---tggaggaatttgatgggactcatttg 332  Q
    ||||||||||||||||||||||   ||||| ||||||||||||||||||||    
50804742 atgattgtaggatgtcctgatgatgtggagcaatttgatgggactcatttg 50804692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 332
Target Start/End: Original strand, 50871135 - 50871185
Alignment:
285 atgattgtaggatgtcctgatg---tggaggaatttgatgggactcatttg 332  Q
    ||||||||||||||||||||||   ||||| ||||||||||||||||||||    
50871135 atgattgtaggatgtcctgatgatgtggagcaatttgatgggactcatttg 50871185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University