View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_1D_low_11 (Length: 292)
Name: NF10301_1D_low_11
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_1D_low_11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 24 - 292
Target Start/End: Original strand, 26218441 - 26218708
Alignment:
| Q |
24 |
gtggagcgtaggcacaacatgcatattggtacagggaactaaatggattgcagatggatccactctacatcttcctacttaaagcgaatataatcttaag |
123 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26218441 |
gtggagcgtaggcaca---tgcatattggtacagggaactaaatggattgcagatggatccactctacatcttcctacttaaagcgagtataatcttaag |
26218537 |
T |
|
| Q |
124 |
caactaaagccacagaggacaagttgatatggatgctcgaaaagcatggaaatttctttgttaaaaacacatatcgttcctgtatttgtatgggtgctag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
26218538 |
caactaaagccacagaggacaagttgatacggatgctcgaaaaggatggaaatttctttgttaaaaacacatatcattcctgtatttgtatgggtgctgg |
26218637 |
T |
|
| Q |
224 |
tagctcgaacatccagactccgggagttggcaattcatttggcgag--aaaaataccacccgaagttaata |
292 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26218638 |
tagctcgaacatccaaactccgggagttggcaattcatttggcgagaaaaaaataccacccgaagttaata |
26218708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University