View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_1D_low_13 (Length: 277)
Name: NF10301_1D_low_13
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_1D_low_13 |
 | |
|
| [»] scaffold0197 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0197 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 274
Target Start/End: Complemental strand, 3382 - 3126
Alignment:
| Q |
18 |
gacatcacaacatttgatgctgatggaaagaatcatatgcttgaatcacaacaagacatgatggtgttttcatgcttggaccaacaaggtatggttggtg |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3382 |
gacatgacaacatttgatgctgatggaaagaatcatatgcttgaatcacaacaagacatgatggtgtattcatgcttggaccaacaaggtatggttggtg |
3283 |
T |
|
| Q |
118 |
agtttccaatggattttcaattagaaggatttgaagctatggtaagtggaggagagggtagtagtagccaatggaattgggaggatttgctcttagatat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3282 |
agtttccaatggattttcaattagaaggatttgaagctatggtaagtggaggagagggtagtagtagccaatggaattgggaggatttgctcttagatat |
3183 |
T |
|
| Q |
218 |
ggatctatataatggtttttcttagattattgttccttattgccaatagggaagaca |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3182 |
ggatctatataatggtttttcttagattattgttccttattgccaatagggaagaca |
3126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University