View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_1D_low_14 (Length: 256)
Name: NF10301_1D_low_14
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_1D_low_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 22 - 256
Target Start/End: Original strand, 30887423 - 30887659
Alignment:
| Q |
22 |
aaatagatgatatatttgtttttacaatgatgtcttggaaggaaacacttttccttttgaagttatatagatagatgaatggta------tccccatttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30887423 |
aaatagatgatatatttgtttttacaatgatgtcttggaaggaaacacttttccttttgaagttatatagatagatgaatggtagacctatccccatttt |
30887522 |
T |
|
| Q |
116 |
gtttcccctacataggtaactaggttttgttgtgtgaccttgtctatctgttatgtatgtggagtgttcagacatgaaatagaatagaaagtaagaaaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30887523 |
gtttcccctacataggtaactaggttttgttgtgcgaccttgtctatctgttatg----tggagtgttcagacatgaaatagaatagaaagtaagaaaat |
30887618 |
T |
|
| Q |
216 |
attgcagttaaggtgtggtttcataagacagtagtgcatgt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30887619 |
attgcagttaaggtgtggtttcataagacagtagtgcatgt |
30887659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University