View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_1D_low_31 (Length: 212)
Name: NF10301_1D_low_31
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_1D_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 34731875 - 34731813
Alignment:
| Q |
6 |
actagtaacttcactaatcagattttctgacaagtaataatctcttttaacttgtaaagtgag |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34731875 |
actagtaacttcactaatcagattttctgacaaggaataatctcttttaacttgtaaagtgag |
34731813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 130 - 170
Target Start/End: Complemental strand, 34731784 - 34731744
Alignment:
| Q |
130 |
tatcctcaaaacaagtttgagatctcttttatctgcgtttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34731784 |
tatcctcaaaacaagtttgagatctcttttatctgcgtttg |
34731744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University