View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_1D_low_33 (Length: 206)
Name: NF10301_1D_low_33
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_1D_low_33 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 97 - 206
Target Start/End: Original strand, 32235766 - 32235875
Alignment:
| Q |
97 |
tttgtgaatggagagaggaagagaggttaattagggcataggaagtgaagtgatgggaaaaattatgaaaaagagggagaagaggtgatgacattagctg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32235766 |
tttgtgaatggagagaggaagagaggttaattagggcataggaagtgaagtgatgggaaaaattatgaaaaagagggagaagaggtgatgacattagctg |
32235865 |
T |
|
| Q |
197 |
tgaatgtatt |
206 |
Q |
| |
|
|||||||||| |
|
|
| T |
32235866 |
tgaatgtatt |
32235875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University