View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_1D_low_34 (Length: 205)
Name: NF10301_1D_low_34
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_1D_low_34 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 94 - 205
Target Start/End: Original strand, 53788091 - 53788203
Alignment:
| Q |
94 |
attccatctatctaggacttcgttaaattcatttgcaaatgcttgttgggaaaatcaa-ctgttccattatttgagtatttgaataattttctttccaat |
192 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||||| || ||||| |
|
|
| T |
53788091 |
attccatctatccaggacttcgttaaattcatttgcaaatgcttgttgggaaaatcaaccggttccattatttgagtattgcaataatttttttcccaat |
53788190 |
T |
|
| Q |
193 |
atttaatcacttc |
205 |
Q |
| |
|
||||||||||||| |
|
|
| T |
53788191 |
atttaatcacttc |
53788203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University