View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_2D_high_26 (Length: 228)
Name: NF10301_2D_high_26
Description: NF10301_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_2D_high_26 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 113 - 228
Target Start/End: Complemental strand, 25814736 - 25814621
Alignment:
| Q |
113 |
tattattttcaatgaaaactttttctttttgtttctttgatgggtgcctcagggacattaagttagcatgacccttacttttaatgataaattcttccgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || ||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814736 |
tattattttcaatgaaaactttttctttttgtttctttgacggatgcttgagggacattaagttagcatgacccttacttttaatgataaattcttccgg |
25814637 |
T |
|
| Q |
213 |
tcgggtagaagaaggg |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25814636 |
tcgggtagaagaaggg |
25814621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 25814848 - 25814798
Alignment:
| Q |
1 |
attatccacccttaaaggttgctcattaagattcattgagatactcttttc |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814848 |
attatccacccttaaaggttgctcattaagattcattgagatactcttttc |
25814798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University