View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_2D_low_21 (Length: 364)
Name: NF10301_2D_low_21
Description: NF10301_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_2D_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 21 - 346
Target Start/End: Complemental strand, 28226483 - 28226158
Alignment:
| Q |
21 |
gtgatcgcctcagaccaaaatatatgacacaaatatgagtgtggctgtggagaacttgaaaaagaatatacgtcattataagaaaatgcagatttcagaa |
120 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226483 |
gtgatggcctcagaccaaaatatatgacacaaatatgagtgtggctgtggaaaacttgaaaaagaatatacgtcattataagaaaatgcagatttcagaa |
28226384 |
T |
|
| Q |
121 |
aggcaagagttcactaggaatgggaaaagaagttatttatgcatctgctcttttcgatttcttatgattctttagaatatgatgcatatgaaaatgaatg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226383 |
aggcaagagttcactaggaatgggaaaagaagttatttatgcatctgctcttttcgatttcttatgattctttagaatatgatgcatatgaaaatgaatg |
28226284 |
T |
|
| Q |
221 |
gaaaaagggcatgtgaaattcacctcaagatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226283 |
gaaaaagggcatgtgaaattcacctcaagatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactc |
28226184 |
T |
|
| Q |
321 |
caagaaatttagagatctttaggttc |
346 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28226183 |
caagaaatttagagatctttaggttc |
28226158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 238 - 338
Target Start/End: Original strand, 13040378 - 13040478
Alignment:
| Q |
238 |
attcacctcaagatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatc |
337 |
Q |
| |
|
|||||||||||| ||||| ||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||| ||||| | || |||||||||||| |
|
|
| T |
13040378 |
attcacctcaaggtagatgtcaatggctctatagaccccatcaaagcaatcccttgcaaaatcaggcaaacattctacaacttctaggaatttagagatc |
13040477 |
T |
|
| Q |
338 |
t |
338 |
Q |
| |
|
| |
|
|
| T |
13040478 |
t |
13040478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University