View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_2D_low_28 (Length: 304)
Name: NF10301_2D_low_28
Description: NF10301_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_2D_low_28 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 20 - 304
Target Start/End: Original strand, 190809 - 191093
Alignment:
| Q |
20 |
aaccggaagatgagcaaggttccgaaaggatacgttgccgtttatgttggaccggagtttagaaggtttgtgattccaataaggttcttgagcatggctg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
190809 |
aaccggaagatgagcaaggttccgaaaggatacgttgccgtttatgttggaccggagtttagaaggtttgtgattccaataaggttcttgagcatggctg |
190908 |
T |
 |
| Q |
120 |
aggtgaaggagttgatggatgatgtagctgaggagtttggttgtgattatcacgctgatggtgctcttcatattccatgtgatgaagattattttcgcaa |
219 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
190909 |
aggtgaaggagttgatggatgatatagctgaggagtttggttgtgattatcacgctgatggtgctcttcatattccatgtgatgaagattattttcgcaa |
191008 |
T |
 |
| Q |
220 |
tgttttgattaattgttttgcaacacaaggcagggtatcttctaagaatcataagatcaaacttggtaataagaatgccttgatt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
191009 |
tgttttgattaattgttttgcaacacaaggcagggtatcttctaagaatcataagatcaaacttggtaataagaatgccttgatt |
191093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University