View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_2D_low_40 (Length: 282)
Name: NF10301_2D_low_40
Description: NF10301_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_2D_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 165 - 263
Target Start/End: Complemental strand, 30528420 - 30528322
Alignment:
| Q |
165 |
ataggtggatccattcattttcttctatcatttatactaaaaatctgaactttttgttgggctgtttctgggttttctgtggaaaacttgggtgttata |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30528420 |
ataggtggatccattcattttcttctatcatttatactaaaaatttgaactttttgttgggctgtttctgggttttctgtggaaaacttgggtgttata |
30528322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 5 - 92
Target Start/End: Complemental strand, 30528580 - 30528493
Alignment:
| Q |
5 |
gttgatcaggatctgttttacttgtgtcggttttgagtttcacaaccatgcatataggtatgcaaaatgtaataatctaaagcttatg |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30528580 |
gttgatcaggatctgttttacttgtgtcggttttgagtttcacaaccatgcatataggtatgcaaaatgtaataatctaaagcttatg |
30528493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University