View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_2D_low_52 (Length: 264)
Name: NF10301_2D_low_52
Description: NF10301_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_2D_low_52 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 112 - 264
Target Start/End: Complemental strand, 364215 - 364073
Alignment:
| Q |
112 |
gtacttttggttagttttaattcaagttagttgcaatagttacttacggttagcaatagcaatttatggtttgttataagccatttacggtgtatagttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
364215 |
gtacttttggttagttttaattcaagttagttgcaatagttacttacggttagcaatagcaatttatggtttgttataagccatttacggtgtatag--- |
364119 |
T |
 |
| Q |
212 |
gttacagtttggaaaactacttgtttttcaagtaacatgtgtatataaacctt |
264 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
364118 |
-------tttggaaaacaacttgtttttcaagtaacatgtgtatataaacctt |
364073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 119
Target Start/End: Original strand, 363101 - 363207
Alignment:
| Q |
13 |
catcagcaatatttggagacatggaggaagatgatccggaataattccgtcggtaatgatggggatcatgatcatgagacttaggcattggattctcctg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
363101 |
catcagcaatatttggagacatggaggaagatgatccggaataattccgacggtaacgatggggatcatgatcatgagacttaggcattgaattctcctg |
363200 |
T |
 |
| Q |
113 |
tactttt |
119 |
Q |
| |
|
||||||| |
|
|
| T |
363201 |
tactttt |
363207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 119
Target Start/End: Complemental strand, 41024094 - 41024035
Alignment:
| Q |
60 |
cgtcggtaatgatggggatcatgatcatgagacttaggcattggattctcctgtactttt |
119 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||| || |||||||||||||| ||||||| |
|
|
| T |
41024094 |
cgtcggtaacgaaggggaacatgatcatgagactcagacattggattctcctctactttt |
41024035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University