View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_2D_low_64 (Length: 204)
Name: NF10301_2D_low_64
Description: NF10301_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_2D_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 23965338 - 23965225
Alignment:
| Q |
19 |
aatcatcacttaacatatcctcatcttcactctgcagaagctccgatgaatcttcattcaacggatcctcatgcaaatcctcattcttctgatcctcatc |
118 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23965338 |
aatcttcacttaacatatcctcatcctcactctgctgaagctccgatgaatcttcattcaacggatcctcatgcaaatcctcattcttctgatcctcatg |
23965239 |
T |
|
| Q |
119 |
tgaattctacaaca |
132 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
23965238 |
tgaattctacaaca |
23965225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 204
Target Start/End: Original strand, 23964692 - 23964728
Alignment:
| Q |
168 |
atatcataacccgaaaaatataacagccgcaaaccct |
204 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23964692 |
atatcaaaacccgaaaaatataacagccgcaaaccct |
23964728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University