View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_high_3 (Length: 373)
Name: NF10301_high_3
Description: NF10301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 153 - 284
Target Start/End: Original strand, 37450481 - 37450612
Alignment:
| Q |
153 |
cagtttttgatgaatttaaatctgcatttcattgcattatgtctccgtttgctcatttgacattgcctatgagccatactcaacagttttatatgtgttt |
252 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37450481 |
cagttttttatgaatttgaatctgcatttcattgcattatgtctccgttttctcatttgacattgcctatgagccatactcaacagttttatatgtgttt |
37450580 |
T |
 |
| Q |
253 |
taactattattagaattaagaaatacatcaaa |
284 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
37450581 |
taactattactagaattaagaaatacatcaaa |
37450612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 37450393 - 37450497
Alignment:
| Q |
1 |
tccaacaaatctaaagtgcttaaatggaaagctgcccttactgaagcagccaatatatctggatgggacagtcacacctatgagtaagcagttttttatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37450393 |
tccaacaaatctaaagtgcttaaatggaaagctgcccttactgaagcagccaatatatctggatgggacagtcacacctatgagtaagcagttttttatg |
37450492 |
T |
 |
| Q |
101 |
aattt |
105 |
Q |
| |
|
||||| |
|
|
| T |
37450493 |
aattt |
37450497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 15 - 70
Target Start/End: Complemental strand, 6074411 - 6074356
Alignment:
| Q |
15 |
agtgcttaaatggaaagctgcccttactgaagcagccaatatatctggatgggaca |
70 |
Q |
| |
|
||||||||| |||| | ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6074411 |
agtgcttaagtggagatctgcccttactgaagcagccactatatctggatgggaca |
6074356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 12 - 101
Target Start/End: Complemental strand, 6196936 - 6196847
Alignment:
| Q |
12 |
taaagtgcttaaatggaaagctgcccttactgaagcagccaatatatctggatgggacagtcacacctatgagtaagcagttttttatga |
101 |
Q |
| |
|
|||||||||||| ||||||| |||| | |||||||||||| ||||||||||||| ||| ||| ||| | |||||||||| |||||||| |
|
|
| T |
6196936 |
taaagtgcttaactggaaagttgccttggctgaagcagccactatatctggatggcacactcaaacccacaagtaagcagtgttttatga |
6196847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University