View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_low_16 (Length: 250)
Name: NF10301_low_16
Description: NF10301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 8674181 - 8673936
Alignment:
| Q |
1 |
taccaagaaattattaggagtaaaatcccaatttaagaagcttgtttgcttgccttaattgagtgaaatg-ggggtaaatcaaaactcggtcaaatggca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
8674181 |
taccaagaaattattaggagtaaaatcccaatttaagaagcttgtttacttgccttaattgagtgaaatgaggggtaaatcaaaactcggtcaaattgca |
8674082 |
T |
|
| Q |
100 |
agggcgaaaaacatctattaaccccatattattagatgcatattcaacatgtgttgatttgtctggtacgtacgaatggtgagggacttgagagttagtt |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8674081 |
agggcgaaaaacatctactaaccccatattattagatgcatattcaacatgtgttgatttgtctggtacgtacgaatggtgatggacttgagagttagtt |
8673982 |
T |
|
| Q |
200 |
gttgcttatgaagaaaattcgattggagagaaaagttcatctcact |
245 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8673981 |
gttgcttatggagaaaattcgattggagagaaaagttcatctcact |
8673936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 8688315 - 8688383
Alignment:
| Q |
1 |
taccaagaaattattaggagtaaaatcccaatttaagaagcttgtttgcttgccttaattgagtgaaat |
69 |
Q |
| |
|
|||||| |||||||||||| | |||||||| |||||||| |||||||||||||||||||| | |||||| |
|
|
| T |
8688315 |
taccaataaattattaggaatgaaatcccagtttaagaaacttgtttgcttgccttaatttactgaaat |
8688383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 71
Target Start/End: Complemental strand, 8692409 - 8692344
Alignment:
| Q |
3 |
ccaagaaattattaggagtaaaatccc-aatttaagaagcttgtttgcttgccttaattgagtgaaatgg |
71 |
Q |
| |
|
|||||||| |||||||||||||||||| ||| |||||||||||| |||| ||||||||||||||||| |
|
|
| T |
8692409 |
ccaagaaagtattaggagtaaaatcccaaatataagaagcttgt----ttgcgttaattgagtgaaatgg |
8692344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University