View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_low_18 (Length: 239)
Name: NF10301_low_18
Description: NF10301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 53838861 - 53839083
Alignment:
| Q |
1 |
gatttacatatgtcaatgtatgaaccaatcctatattgggcacgttggcaacatagaattttgtcatatgttgcattgatatatggactgtacctttaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53838861 |
gatttacatatgtcaatgtatgaaccaatcctatactgggcacgttggcaacatagaattttgtcatatgttgcattgatatatggactgtacctttaca |
53838960 |
T |
 |
| Q |
101 |
attgattgattgattgtgtttgaaattaagtgatataatcacgattttctcatgtttgattgtgtttgaaattaagcctaaacataccttgcacaactca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53838961 |
attgattgattgattgtgtttgaaattaagtgatataatcacgattttctcatgtttgattgtgtttgaaattaagcctaaacataccttgcactactca |
53839060 |
T |
 |
| Q |
201 |
gatgcttttacaatgtgcgatac |
223 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
53839061 |
gaagcttttacaatgtgcgatac |
53839083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University