View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10301_low_19 (Length: 233)
Name: NF10301_low_19
Description: NF10301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10301_low_19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 3 - 233
Target Start/End: Original strand, 27584219 - 27584449
Alignment:
| Q |
3 |
agatacatgttatgaacttcttccctgtgttttatgttgcctctgacaatattttgcttaatgacggacaggaccgtgcttctgaaaacgaggagttgaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27584219 |
agatacatgttatgaacttcttccctgtgttttatgttgcctctgacaatattttgcttaatgacggacaggaccgtgcttctgaaaacgaggagttgaa |
27584318 |
T |
 |
| Q |
103 |
atctcaaattgaagaggcctatatgttagtggaaaaattgatggctgaaaatgctgaacttgttgagaaggtaaatatgcagggttcttgatggttttgt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27584319 |
atctcaaattgaagaggcctatatgttagtggaaaaattgatggctgaaaatgctgaacttgttgagaaggtaaatatgcagggttcttgatggttttgt |
27584418 |
T |
 |
| Q |
203 |
aatgacagtttttattattttattttctccc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27584419 |
aatgacagtttttattattttattttctccc |
27584449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University