View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10302_low_8 (Length: 253)
Name: NF10302_low_8
Description: NF10302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10302_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 32 - 236
Target Start/End: Original strand, 38634168 - 38634372
Alignment:
| Q |
32 |
tattttattatttcaattccaatcaaaatttgggtttgatgattagttgttcgaacttggtgatttacacttaagatggctggagaagattttgatggaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38634168 |
tattttattatttcaattccaatcaaaatttgggtttgatgattagttgtttgaacttggtgatttacacttaagatggctggagaagattttgatggaa |
38634267 |
T |
 |
| Q |
132 |
accacatatagaatattggaatatatgagggataactatatagaattcaatctttattttaactttcaccatgtccacttagaatttagaaactactaga |
231 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38634268 |
accacatatagaatattagaatatatgagggataattatatagaattcaatctttattttaactttcaccatttccacttagaatttagaaactactaga |
38634367 |
T |
 |
| Q |
232 |
gctat |
236 |
Q |
| |
|
||||| |
|
|
| T |
38634368 |
gctat |
38634372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University