View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10303_low_6 (Length: 226)
Name: NF10303_low_6
Description: NF10303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10303_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 23188287 - 23188482
Alignment:
| Q |
16 |
tgaaccaaataaaattcaaaaagaaaaccaaatttagtttcgtagctgatacaaattgcaaaaggtcatagcatcaaatat--atattaacaaaattcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23188287 |
tgaaccaaataaaattcaaaaagaaaaccaaatttagtttcgtagctgatgcaaattgcaaaaggtcatagcatcaaatatatatattaacaaaattcat |
23188386 |
T |
 |
| Q |
114 |
tttgaaaaattgtcaaactcttgtttctgcgttgtgcttttctcggttctatgaggtgcttcgtgcacaaacaatgtatagcagattgtgtcatct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23188387 |
tttgaaaaattgtcaaactcttgtttctgcgttgtgcttttctcggttctatgaggtgcttcgtgcacaaacaatgtatagcagattgtgtcatct |
23188482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University