View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10305_high_17 (Length: 249)
Name: NF10305_high_17
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10305_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 20741678 - 20741435
Alignment:
| Q |
1 |
cagacaactactacaaggttaaaaacatgttgtacaatttaccatcattgactatgagtactactcggaggcgtttataacattgcaacataattcggnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
20741678 |
cagacaactactacaaggttaaaaacatgttgtacaatttaccatcattgactatgagtactactcggaagcgtttataacattgcaacataattcagtt |
20741579 |
T |
|
| Q |
101 |
nnnnncataacaaattccagattttattgccacctcccaaactcatatcaccaccaccctttatcaatttcannnnnnnaccacccttcacggtcaccac |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20741578 |
tttttcataacaaattctagattttattgccacctcccaaactcatatcaccaccaccctttatcaatttcatttttttaccacccttcacggtcaccac |
20741479 |
T |
|
| Q |
201 |
cggcaccataataacttcctaattcccactctcttcttctctct |
244 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
20741478 |
cggcaccataataacttcctaattcctactctcttcttttctct |
20741435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 20733800 - 20733640
Alignment:
| Q |
1 |
cagacaactactacaaggttaaaaacatgttgtacaatttaccatcattgactatgagtactactcggaggcgtttataacattgcaacataattcggnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20733800 |
cagacaactactacaaggttaaaaacatgttgtacaatttaccaccattggctatgagtactactcggaagcgtttataacattgcaacataattcaatt |
20733701 |
T |
|
| Q |
101 |
nnnnncataacaaattccagattttattgccacctcccaaactcatatcaccaccaccctt |
161 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20733700 |
tttttcataacaaattctagattttattgccacctcccaaactcatatcaccaccaccctt |
20733640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 180 - 244
Target Start/End: Complemental strand, 20733648 - 20733584
Alignment:
| Q |
180 |
accacccttcacggtcaccaccggcaccataataacttcctaattcccactctcttcttctctct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
20733648 |
accacccttcacggtcaccaccggcaccataataacttcctaattcctactctcttcttttctct |
20733584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University