View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10305_high_20 (Length: 241)
Name: NF10305_high_20
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10305_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 45831935 - 45832145
Alignment:
| Q |
13 |
cagagagtattcatagggattttgtgactttaaaatgatagaggttagtgagggattagaatagtctttttggagtatgaagaaaccaatttaagaagca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45831935 |
cagagagtattcatagggattttgtgacttcaaaatgatacaggttggtgagggattggaatagtctttttggagtatgaagaaaccaattaaagaagca |
45832034 |
T |
 |
| Q |
113 |
attgccttaaagaatctaattgaatttatgcaaaatcacagttacgtgtcttttgataattctatgacatatctattgatctcagataaacactttcatt |
212 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45832035 |
attgctttaaaaaatctgattgaatttatgcaaaatcacagttttgtgtcttttgacaattctatgacatatctattgatctcagataaacactttcatt |
45832134 |
T |
 |
| Q |
213 |
aattctttttg |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
45832135 |
aattctttttg |
45832145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 118 - 194
Target Start/End: Original strand, 32524471 - 32524547
Alignment:
| Q |
118 |
cttaaagaatctaattgaatttatgcaaaatcacagttacgtgtcttttgataattctatgacatatctattgatct |
194 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||| ||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
32524471 |
cttaaagaatctgattgaatttatccaaaatcacatttatgtgtcttttgaccattttatgacatatctattgatct |
32524547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 118 - 194
Target Start/End: Complemental strand, 43604157 - 43604081
Alignment:
| Q |
118 |
cttaaagaatctaattgaatttatgcaaaatcacagttacgtgtcttttgataattctatgacatatctattgatct |
194 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | | ||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
43604157 |
cttaaagaatctaattgcatttatgcaaaatcaaatctctgtgtcttttgaccattttatgacatatctattgatct |
43604081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 125 - 223
Target Start/End: Complemental strand, 30178429 - 30178331
Alignment:
| Q |
125 |
aatctaattgaatttatgcaaaatcacagttacgtgtcttttgataattctatgacatatctattgatctcagataaacactttcattaattctttttg |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||| || ||| |||||| ||||||||| |||||||||| ||| | ||| |||||||||||| |||||||| |
|
|
| T |
30178429 |
aatccaattgaatttatgcaaaatcacacctatatgttttttgacaattctatgtcatatctatttatccaaaatagacactttcattatctctttttg |
30178331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University