View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10305_high_24 (Length: 225)
Name: NF10305_high_24
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10305_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 35 - 210
Target Start/End: Original strand, 42695358 - 42695533
Alignment:
| Q |
35 |
gtaaatgtgtggaattggtggctataacaaactcaaatctcgatatgcacacctctatcttatttttctttcaatccaaggcacacatacaatcatacat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42695358 |
gtaaatgtgtggaattggtggctataacaaactcaaatctcgatatgcacacctctatcttattttcctttcaatccaaggcacacatacaatcatacat |
42695457 |
T |
 |
| Q |
135 |
gtactgagtggactaatggactctatcttattggtttagactcactttcnnnnnnngagcaaaatagtttagactc |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42695458 |
gtactgagtggacaaatggactctatcttattggtttagactcactttctttttttgagcaaaatagtttagactc |
42695533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University