View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10305_high_7 (Length: 414)
Name: NF10305_high_7
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10305_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 18 - 406
Target Start/End: Original strand, 26034899 - 26035287
Alignment:
| Q |
18 |
catccctgtgccagcatgcagtatggtactttctaaaggtcaaatacagttgtctggcccttgctatatcacttttcatgtatttgcaacagatggctgc |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26034899 |
catccctgtgccagcatgcagtatagtactttctaaaggtcaaatacagttgtctggcccttgctatatcacttttcatgtatttgcaacagatggctgc |
26034998 |
T |
|
| Q |
118 |
atgctttatcctgaaattgttgctaattgtgttttaattacgaaaacttttggactacacaatagagtaaacaaaacaataaagtttgaataacttcctc |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
26034999 |
atgctttattgtgaaattgttgctaattgtgttttaattacgaaaacttttggactacacaatagagtaaacaaattaataaagtttgaatatcttcctc |
26035098 |
T |
|
| Q |
218 |
ttaacagtatgtttttgaccaggctattgattgattgatttatatgagttgtgtttggtttttaactttggagatgatgaacataaaagagcatatcttg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26035099 |
ttaacagtatgtttttgaccaggctattgattgattgatttatatgagttgtgtttggtttttaactttggagatgatgaacataaaagagcatatcttg |
26035198 |
T |
|
| Q |
318 |
caacaatcaatgtgttttccccagtctaattatcggttatccttcattagtctacttttttaatcaaaacttctattcgtcttcttctc |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26035199 |
caacaatcaatgtgttttccccagtctaattatcggttatccttcattagtctacttttttaatcaaaacttctattcgtcttcttctc |
26035287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University