View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10305_low_16 (Length: 313)
Name: NF10305_low_16
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10305_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 73 - 298
Target Start/End: Complemental strand, 16807556 - 16807334
Alignment:
| Q |
73 |
ttcccatgcaaacagcctcatatacgccacttctaggcctcctcattaacaccccaacccaaaagatacatgtcagcgacattgataccatcaacaactc |
172 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16807556 |
ttcccatgcaaacagcctcata--cgccacttctag-cctccccattaacaccccaacccaaaagatacatgtcagcgacattgataccatcaccaactc |
16807460 |
T |
|
| Q |
173 |
ccatcaggagcgcgggcaattaagtgtaaaatatttgccctcgcattgaaagttgcatcgaggacttggtttaagggccttaaggacgactctattgatt |
272 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
16807459 |
ccatcaggagctcgggcaattaagtgtaaaatatttgtcctcgcattgaaagttgcatcgaggacttggtttaaaggcctttaggacgactctattgatt |
16807360 |
T |
|
| Q |
273 |
gttagagggagctttgtgaagagctt |
298 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16807359 |
gttagagggagctttgtgaagagctt |
16807334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University