View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10305_low_21 (Length: 253)
Name: NF10305_low_21
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10305_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 37658832 - 37658596
Alignment:
| Q |
1 |
tagtaaaaacatttttagtgcttgatgaattaaccattaaggaaaccaaaaggaatcatgaacagaaatttggtcaaaaggggatatgaatttcttaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658832 |
tagtaaaaacatttttagtgcttgatgaattaaccattaaggaaaccaaaaggaatcatgaacagaaatttggtcaaaaggggatatgaatttcttaaga |
37658733 |
T |
|
| Q |
101 |
cactttttatgggatctttttatgctttcatgtggaagaaagtactatacttttaactcttaacaaaaacgtaatctccatgcaccttcctttctctcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658732 |
cactttttatgggatctttttatgctttcatgtggaagaaagtactatactttt-actcttaacaaaaacgtaatctccatgcaccttcctttctctcta |
37658634 |
T |
|
| Q |
201 |
aaaatgagaattcagacaaacagagtagtagcaaaaga |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658633 |
aaaatgagaattcagacaaacagagtagtagcaaaaga |
37658596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University