View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10305_low_28 (Length: 241)

Name: NF10305_low_28
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10305_low_28
NF10305_low_28
[»] chr7 (2 HSPs)
chr7 (153-231)||(42719900-42719977)
chr7 (1-73)||(42719748-42719820)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 153 - 231
Target Start/End: Original strand, 42719900 - 42719977
Alignment:
153 aggcagagtttgaggggggaggaacctgacaagtgggttaattgagtcaattctgggatgtcgtatctacctgtctctg 231  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42719900 aggcagagtttgagggg-gaggaacctgacaagtgggttaattgagtcaattctgggatgtcgtatctacctgtctctg 42719977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 42719748 - 42719820
Alignment:
1 tactcaccgtacctgcctttggtttactcattactactcttttggtgtgaaagtttggtatgaaattcaggga 73  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
42719748 tactcaccgtacctgcctttggtttactcattgctactcttttggtgtgaaagtttggtatgaaattcaggga 42719820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University