View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10305_low_28 (Length: 241)
Name: NF10305_low_28
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10305_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 153 - 231
Target Start/End: Original strand, 42719900 - 42719977
Alignment:
| Q |
153 |
aggcagagtttgaggggggaggaacctgacaagtgggttaattgagtcaattctgggatgtcgtatctacctgtctctg |
231 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42719900 |
aggcagagtttgagggg-gaggaacctgacaagtgggttaattgagtcaattctgggatgtcgtatctacctgtctctg |
42719977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 42719748 - 42719820
Alignment:
| Q |
1 |
tactcaccgtacctgcctttggtttactcattactactcttttggtgtgaaagtttggtatgaaattcaggga |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42719748 |
tactcaccgtacctgcctttggtttactcattgctactcttttggtgtgaaagtttggtatgaaattcaggga |
42719820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University