View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10305_low_29 (Length: 232)
Name: NF10305_low_29
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10305_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 2778005 - 2778204
Alignment:
| Q |
20 |
ctaactacttttttcgtattctgcacaggttcttgtggaacgtaaatcatctgcgagagttttgacattgaacaggcccaaacaattgaatgctctctct |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2778005 |
ctaactacttttttcgtattgtgcacaggttcttgtggaacgtaaatcatctgcgagagttttgacattgaacaggcccaaacaattgaatgctctctct |
2778104 |
T |
 |
| Q |
120 |
ttttatatggtactatttcataattcatttcatgcattgctttatttcttcaatttttcta-ttttgagtagtaacatatgatacaaaactgtacctttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2778105 |
ttttatatggtactatttcataattcatttcatgcattgctttatttcttcaatttttctacttttgagtagtaacatatgatacaaaactgtacctttg |
2778204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University