View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10305_low_30 (Length: 232)
Name: NF10305_low_30
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10305_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 42719768 - 42719571
Alignment:
| Q |
14 |
caaaggcaggtacggtgagtagtgatggggaaagcaaagagactgcaccaaagagagcagaagtaagcagcagagggtaaggtggtatggagagaaaggt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42719768 |
caaaggcaggtacggtgagtagtgatggggcaagcaaagagactgcaccaaagagagcagaagtaagcagcagagggtaaggtggtatggagagaaaggt |
42719669 |
T |
 |
| Q |
114 |
attgtaggacccacttacaaaagataggtgacatcatcacagtgcctaaatggagaatttaggcca-tttgaaatcagaaatgaggaatcaattttct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42719668 |
attgtaggacccacttacaaaagataggtgacatcatcacagtgcctaaatggagaatttaggccattttgaaatcagaaatgaggaatcaattttct |
42719571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University