View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10305_low_31 (Length: 229)
Name: NF10305_low_31
Description: NF10305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10305_low_31 |
 |  |
|
| [»] chr3 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 229
Target Start/End: Complemental strand, 20741931 - 20741707
Alignment:
| Q |
5 |
caattttatgtcgcttgccacctcatatagaaaaaacagcttgtactatcgtgggaacaaagaaatgcatgccatgtattttattcatatttacatgcat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
20741931 |
caattttatgtcgcttgccacctcatatagaaaaaacagcttgtactatcgtgtgaacaaagaaatgcatgcaaggtattttattcatatttacatgcat |
20741832 |
T |
 |
| Q |
105 |
aaaataagatacattgcaatatagctgcactctttgatgatgaattttctattcttgtacactctgttctcttttcattccaaattaagtttcgttgtag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20741831 |
aaaataagatacattgcaatatagctgcactctttgatgatgaattttctattcttgtacactctgttctcttttcattccaaaacaagtttcgttgtag |
20741732 |
T |
 |
| Q |
205 |
tagcaaaaaatagtgaacacaaaaa |
229 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
20741731 |
tagcaaaaaataatgaacacaaaaa |
20741707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 5 - 157
Target Start/End: Complemental strand, 20734076 - 20733923
Alignment:
| Q |
5 |
caattttatgtcgcttgccacctcatatagaaaaaacagcttgtactatcgtgggaacaaagaaatgcatgccatgtattttattcatatttacatgcat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20734076 |
caattttatgtcgcttgccacctcatatagaaaaaacagcttgtactatcgtgtgaacaaagaaatgcatgccagatattttattcatatttacatgcat |
20733977 |
T |
 |
| Q |
105 |
-aaaataagatacattgcaatatagctgcactctttgatgatgaattttctatt |
157 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20733976 |
aaaaataatatacattgcaatatagctgcactctttgatgataaattttctatt |
20733923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 155 - 229
Target Start/End: Complemental strand, 20733902 - 20733828
Alignment:
| Q |
155 |
attcttgtacactctgttctcttttcattccaaattaagtttcgttgtagtagcaaaaaatagtgaacacaaaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
20733902 |
attcttgtacactctgttctcttttcattccaaattaagtctcgttgtaatagcaaaaaatagtgaacacaaaaa |
20733828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 44
Target Start/End: Complemental strand, 20746351 - 20746312
Alignment:
| Q |
5 |
caattttatgtcgcttgccacctcatatagaaaaaacagc |
44 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20746351 |
caattttatgtcccttgccacctcatatagaaaaaacagc |
20746312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 229
Target Start/End: Complemental strand, 20730273 - 20730197
Alignment:
| Q |
155 |
attcttgtacactct--gttctcttttcattccaaattaagtttcgttgtagtagcaaaaaatagtgaacacaaaaa |
229 |
Q |
| |
|
||||||||||||| | |||||||| ||||| |||| ||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
20730273 |
attcttgtacactttaagttctcttctcatttcaaaataagtctcaatatagtagcaaaaaatagtgaacacaaaaa |
20730197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University