View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10306_low_3 (Length: 396)
Name: NF10306_low_3
Description: NF10306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10306_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 11 - 323
Target Start/End: Original strand, 10975864 - 10976176
Alignment:
| Q |
11 |
cacagaacaaaccttgctttccatagttatcaaaccttctcttggttttctcaactgttgcttttatggccagcgctggagcactgtccggagcgtaaag |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10975864 |
cacacaacaaaccttgctttccatagttatcaaaccttctcttggttttctcaactgttgcttttatggccagcgctggagcgctgtccggagcgtaaag |
10975963 |
T |
 |
| Q |
111 |
cttgagggatgattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgttagaccggagatgtcggcgacagcg |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10975964 |
cttgagtgatgattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgttaggccggagatgtcggcgacagcg |
10976063 |
T |
 |
| Q |
211 |
gggagtggtgatgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcgttgcttggtttttcttggtttgtgc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10976064 |
gggagtggtgatgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcgttggttggtttttcttggtttgtgc |
10976163 |
T |
 |
| Q |
311 |
tgcagtggatgat |
323 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10976164 |
tgcagtggatgat |
10976176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University