View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10307_high_5 (Length: 386)
Name: NF10307_high_5
Description: NF10307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10307_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 15 - 274
Target Start/End: Complemental strand, 27203417 - 27203158
Alignment:
| Q |
15 |
agaaccaccactgaagagttgttgatcagaatgtaaaagtccttttttgtttactagattcttgaaataagcattgtcaaataatacattggttgtgaca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27203417 |
agaaccaccactgaagagttgttgatcagaatgtaaaagtccttttttgttaacaagattcttgaaataagcattgtcaaataatacattggttgtgaca |
27203318 |
T |
|
| Q |
115 |
tcaagtgaggtaaggttgctatcaccacctgtacttggacagtttgatttcactgaggttgcgaaatttgaatcaatgattgtctcgttataaatccggc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27203317 |
tcaagtgaggtaaggttgctatcaccacctgtacttggacagtttgatttcactgaggttgcgaaatttgaatcaatgattgtctcgttataaatccggc |
27203218 |
T |
|
| Q |
215 |
ctctgaacaattgacacctggcttgtccggtagtatgagcacctatgcatccaagttttc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27203217 |
ctctgaacaattgacacctggcttgtccggttgtatgagcacctatgcatccaagttttc |
27203158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 328 - 378
Target Start/End: Complemental strand, 27203089 - 27203040
Alignment:
| Q |
328 |
ggttcgtgaccgcaattcaagataaaacatcatgacatttgatgtctctgc |
378 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
27203089 |
ggttcgtgaccgcaat-caagatgaaacatcatgacatttgatgtctctgc |
27203040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University