View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10307_high_6 (Length: 359)
Name: NF10307_high_6
Description: NF10307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10307_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 283 - 351
Target Start/End: Original strand, 36962309 - 36962377
Alignment:
| Q |
283 |
ccctcccctactgcatagtgcatacagataatcatgcgcttctatctgtcttttacgtatatctgtgct |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
36962309 |
ccctcccctactgcatagtgcatacagatattcatgtgcttctatctgtcttttgcgtatatttgtgct |
36962377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 13170004 - 13169955
Alignment:
| Q |
56 |
aaacttaaggtctatttggttcaac-gaggggaggtgaagggagggattt |
104 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
13170004 |
aaacttaaggtctgtttggttcaacagaggggaggggaagagagggattt |
13169955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University