View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10307_high_6 (Length: 359)

Name: NF10307_high_6
Description: NF10307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10307_high_6
NF10307_high_6
[»] chr1 (1 HSPs)
chr1 (283-351)||(36962309-36962377)
[»] chr8 (1 HSPs)
chr8 (56-104)||(13169955-13170004)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 283 - 351
Target Start/End: Original strand, 36962309 - 36962377
Alignment:
283 ccctcccctactgcatagtgcatacagataatcatgcgcttctatctgtcttttacgtatatctgtgct 351  Q
    |||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||| ||||||    
36962309 ccctcccctactgcatagtgcatacagatattcatgtgcttctatctgtcttttgcgtatatttgtgct 36962377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 13170004 - 13169955
Alignment:
56 aaacttaaggtctatttggttcaac-gaggggaggtgaagggagggattt 104  Q
    ||||||||||||| ||||||||||| ||||||||| |||| |||||||||    
13170004 aaacttaaggtctgtttggttcaacagaggggaggggaagagagggattt 13169955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University