View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10307_low_5 (Length: 424)
Name: NF10307_low_5
Description: NF10307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10307_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 381; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 23 - 407
Target Start/End: Complemental strand, 10461894 - 10461510
Alignment:
| Q |
23 |
agggatatgtttggacccaacatccccgacgctattgacatacttgttccctgctggtggaataacaggtttcagcgcggaagctacagcaactttccga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461894 |
agggatatgtttggacccaacatccccgacgctattgacatacttgttccctgctggtggaataacaggtttcagcgcggaagctacagcaactttccga |
10461795 |
T |
|
| Q |
123 |
ttatctccaatggtaaagttttttataacattaaggtaataaggtttgcttatcatgctgcattttcatattatttaatcattgtttgacaattcccctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461794 |
ttatctccaatggtaaagttttttataacattaaggtaataaggtttgcttatcatgctgcattttcatattatttaatcattgtttgacaattcccctt |
10461695 |
T |
|
| Q |
223 |
tgaatattttctgctcttaaatatatcaattgatgctatagctatacttgtcttatatcagtgcatccaaagacaaaacaggggatgacctggagattac |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461694 |
tgaatattttctgctcttaaatatatcaattgatgctatagctatacttgtcttatatcagtgcatccaaagacaaaacaggggatgacctggagattac |
10461595 |
T |
|
| Q |
323 |
agcttgttactataattaattatcactcttcactataattctgtcttcttcttgtgtcactgatgattgttttgacgtactaatt |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461594 |
agcttgttactataattaattatcactctttactataattctgtcttcttcttgtgtcactgatgattgttttgacgtactaatt |
10461510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University