View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10308_high_4 (Length: 334)
Name: NF10308_high_4
Description: NF10308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10308_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 80 - 319
Target Start/End: Complemental strand, 37879130 - 37878891
Alignment:
| Q |
80 |
atatcacctttctataaatgagtccctcttctatgatttttgactataaaagtttgaaacttcccttggtgaattgaatttgagtaacatatttttgcta |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879130 |
atatcacctttctataaatgagtccctcttctatgatttttgactataaaagtttgaaactttccttggtgaattgaatttgagtaacatatttttgcta |
37879031 |
T |
 |
| Q |
180 |
gaataactattttccttactggttgattcttttttgttgttcttttgtttaacttttgtggcttaaatcttataatttattgtaatattgtgtgatgaat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37879030 |
gaataactattttccttactggttgattcttttttgttgttcttttgtttaacttttgtggcttaaatcttataatttatggtaatattgtgtgatgaat |
37878931 |
T |
 |
| Q |
280 |
gcaggctgagaggaaaaagctgaggttcaaacaagtatgt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37878930 |
gcaggctgagaggaaaaagctgaggttcaaacaagtatgt |
37878891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University