View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10309_high_5 (Length: 249)
Name: NF10309_high_5
Description: NF10309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10309_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 43173978 - 43174217
Alignment:
| Q |
1 |
gacatggcatgctggtcctctatttaagtctgatacaatggacttttacaatctagaactgagcaatacaaatgtaagtttttcaccttccctataaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43173978 |
gacatggcatgctggtcctctatttaagtctgatacaatggacttttacaatctagaactgagcaatacaaatgtaagtttttcaccttccctataaata |
43174077 |
T |
 |
| Q |
101 |
aagtgttacatgcacctgacctgaattcatttgcaatgctctttattatttcagtgtaggacatgggaattgtacttattttgtcttttttatggtttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43174078 |
aagtgttacatgcacctgacctgaattcatttgcaatgctctttattatttcagtgtaggacatgggaattgtacttattttgtcttttttatggtttag |
43174177 |
T |
 |
| Q |
201 |
tcgaccttgctgtgatttatgtatggttttttattctgtg |
240 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43174178 |
tcgacgttgctgtgatttatgtatggttttttattctgtg |
43174217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 2 - 85
Target Start/End: Original strand, 43176812 - 43176895
Alignment:
| Q |
2 |
acatggcatgctggtcctctatttaagtctgatacaatggacttttacaatctagaactgagcaatacaaatgtaagtttttca |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
43176812 |
acatggcatgctggtcctctatttaagtctagcacgatggacttttacaatctagagctggccaatacaaatgtaagtttttca |
43176895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University