View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10309_low_1 (Length: 398)
Name: NF10309_low_1
Description: NF10309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10309_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 278 - 388
Target Start/End: Complemental strand, 29948364 - 29948254
Alignment:
| Q |
278 |
agcttacgaggactgcaacaagcatcttgtatcaatgagacataggttggaaaccgggaaccgcatagtattaaaactaagaagacatagcaatccgcat |
377 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29948364 |
agcttacgaggactgcagcaagtatcttgtatcaatgagacataggttggaaaccaggaaccgcatagtattaaaactaagaagacatagcaatctgcat |
29948265 |
T |
|
| Q |
378 |
gttgtcctatg |
388 |
Q |
| |
|
||||||||||| |
|
|
| T |
29948264 |
gttgtcctatg |
29948254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 232
Target Start/End: Complemental strand, 29936342 - 29936230
Alignment:
| Q |
127 |
tagttttattatattagctttgtttgcattttttcattttgatgaactttgtacaaaagattatgtccttt-------tgtcctatgttagatatatatt |
219 |
Q |
| |
|
|||||| |||||||| |||||| |||||||||||||||||||||| ||||||| ||||||||| ||||| ||| || ||||||||||||||| |
|
|
| T |
29936342 |
tagtttaattatatttgctttgcctgcattttttcattttgatgaattttgtaccaaagattataacctttgacctagtgtactttgttagatatatatt |
29936243 |
T |
|
| Q |
220 |
gcagcaaagtatc |
232 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
29936242 |
ggagcaaagtatc |
29936230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University