View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10309_low_8 (Length: 238)
Name: NF10309_low_8
Description: NF10309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10309_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 52240510 - 52240306
Alignment:
| Q |
16 |
cagagagtcgagagaagcaaacatggcgaaaagctcaaatagttttgatattcctatgaatccaaagaaggaagatgaaaagcaaaagacagtttctatg |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52240510 |
cagaaagtcgagagaagcaaacatggcgaaaagctcaaatagttttgatattcctatgaatccaaagaaggaagatgaaaagcaaaagacagtttctatg |
52240411 |
T |
 |
| Q |
116 |
agaggtgtagaatatagcaaagctactccccgaggttcattaagcccaggcagaagtatgggaaaaggccgggttaaagggaaggtcaaagaatttgctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52240410 |
agaggtgtagaatatagcaaagctactccccgaggttcattaagcccaggcagaagtatgggaaaaggccgggttaaagggaaggtcaaagaatttgctc |
52240311 |
T |
 |
| Q |
216 |
aaata |
220 |
Q |
| |
|
||||| |
|
|
| T |
52240310 |
aaata |
52240306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University