View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10311_high_13 (Length: 227)
Name: NF10311_high_13
Description: NF10311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10311_high_13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 1158935 - 1158721
Alignment:
| Q |
1 |
atgagattaatgaaaatcgacatgcattccttttagtgtcatcgtattgtcgatcaagctaattgtgatatgttaaaagattttaggcattagcag-aat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
1158935 |
atgagattaatgaaaatcgacatgcattccttttagtgtcatcgtgttgtcgatcaagctaattgtgacatgttaaaagattttaggcattagcagaaat |
1158836 |
T |
|
| Q |
100 |
caaataggtttcactcttgattgaagaacatatacaattaacattcgtgtttttaatcagcggtccgatgtactctacaaggtacctcatatgtggtaca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | |||||||||||||||||||||| |
|
|
| T |
1158835 |
caaataggtttcactcttgattgaagaacatatacaattaacattcgtgtttttaatca------caagct-------aaggtacctcatatgtggtaca |
1158749 |
T |
|
| Q |
200 |
aaacaaggatttgttattcaaagaaaat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1158748 |
aaacaaggatttgttattcaaagaaaat |
1158721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University