View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10311_low_10 (Length: 247)
Name: NF10311_low_10
Description: NF10311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10311_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 34184281 - 34184064
Alignment:
| Q |
18 |
tgaactggaagtgaaattcctactactgagccgcatgcgtatcctccagcgtaagacatgttgctcgactgcaaagtgcttccataaggaggaacttgta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34184281 |
tgaactggaagtgaaattcctactactgagccgcatgcgtatcctccagcgtaagacatgttgctcgactgcaaagtgcatccataaggaggaacttgta |
34184182 |
T |
|
| Q |
118 |
gcatgccagtgtgtcttactgcctcaagtggcctctatgccaaatgtattcgacatacttttaggttatcctagttataagcatcatccaccactgcgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34184181 |
gcatgccagtgtgtcttactgcctcaagtggcctctatgccaaatgtattcgacatacttttaggttatcctagttataagcatcatccaccactgcgtt |
34184082 |
T |
|
| Q |
218 |
ctccctaattttagcctt |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34184081 |
ctccctaattttagcctt |
34184064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 115
Target Start/End: Complemental strand, 9430684 - 9430624
Alignment:
| Q |
55 |
cgtatcctccagcgtaagacatgttgctcgactgcaaagtgcttccataaggaggaacttg |
115 |
Q |
| |
|
|||||| || |||||||||||||||||||| |||| ||| ||||||||||| |||||||| |
|
|
| T |
9430684 |
cgtatcttcgagcgtaagacatgttgctcgcttgcatagtacttccataaggtggaacttg |
9430624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University