View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10311_low_12 (Length: 238)
Name: NF10311_low_12
Description: NF10311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10311_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 1157738 - 1157583
Alignment:
| Q |
71 |
gtgtccaagtaaaacttcttccgaattgaattctaaatatttcagcatatcataaatttatggtttgcttcaggccgtctcaactattagcagtggtgga |
170 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||| ||| |
|
|
| T |
1157738 |
gtgttcaagtaaaacttcttctgaattgaattctaaatatttcagcatatcataaatttatggtttgtttcaggccgtctcaattattagcaatggcgga |
1157639 |
T |
|
| Q |
171 |
tcttgagttcttttgttagggtgctaaatatttatgaaata-atatggttaaattg |
225 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1157638 |
tcttaagttcttttgttcgggtgctaaatatttatgaaatatatatggttaaattg |
1157583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University